2017年[ 技術交流助成 (日本留学) ] 成果報告 ： 年報30号補刷
平成２６年度 技術交流助成成果報告（日本留学）・ラハースレン・ネメフバータル
概要
Study Subject:
FN1 induces Ara-C resistance of the leukemia cells with FLT3-ITD
Purpose
We aimed to study an involvement of the molecules of the extracellular matrix (ECM), fibronectin (FN1) and collagen 4 (COL4), in the FLT3-ITD-induced chemotherapy resistance of the leukemia cells in the bone marrow microenvironment (BM-ME).
Objectives
1. To investigate the effects of the ECMs (FN1 or COL4) on chemotherapy resistance of leukemia cells.
2. To study the involvement of FLT3-ITD mutation on chemotherapy resistance of leukemia cells in presence of ECMs.
3. To clarify the molecular mechanism and to determine the candidate genes for drug resistance of leukemia cells in presence of ECMs.
Background
Acute myeloid leukemia (AML) is a group of genetically heterogeneous hematological malignancies [1]. Cytarabine (Ara-C) is the main cytotoxic agent used in the chemotherapy of AML. Although the most of the patients show good response after the initial course of treatment based on Ara-C, a part of the patients with a certain cytogenetics relapse [2] [3]. One of such common mutations is an internal tandem duplication of the juxta-membrane domain of the FLT3 (FLT3-ITD), found in 30-40 % of cases with cytogenetically normal AML (CN-AML). FLT3-ITD mutation constitutively activates multiple downstream signalling pathways such as STAT3/5, MAPK/ERK and PI3K/AKT [4] [5].
The bone marrow microenvironment was previously found to mediate a resistance of the leukemic cells against the cytotoxic agents, by providing a safe niche with numerous cytokines/growth factors (i.e., PDGF, VEGF, etc.) and cell-cell surface contact molecules (i.e., CXCR4, VCAM1, etc.) [6, 7, 8, 9, 10, 11]. This phenomenon of cell adhesion-mediated drug resistance (CAM-DR) is mediated by β1 integrins, which connect with FN1, COL4 and other extracellular matrix molecules (ECMs) [12]. Also, the chronic myelogenous cells become resistant to drug-induced apoptosis when adhered to FN1 [12].
On the other hand, BM-ME and FLT3-ITD mutation both mediate an Ara-C resistance in the leukemic cells [12]. But the detailed molecular mechanism of this phenomena are still unclear. In this study, we studied effects of the ECMs (FN1 or collagen 4 (COL4)) on chemotherapy resistance of leukemia cells, and examined a potential role of p21cip1 as downstream signalling pathway of FLT3-ITD in inducing cell adhesion-mediated drug resistance in leukemia cells in presence of ECMs (FN1, COL4). We also confirmed that the inhibition of p21 sensitises the leukemia cells to chemotherapy.
Methods
1.1. Cell lines and reagents
Human leukemia cells K562, MOLM-14 [13] and MV4:11 (ATCC, Manassas, VA, USA) were cultured in RPMI-1640 medium (Wako, Osaka, Japan) containing 10% Fetal bovine Serum (FBS; Corning, USA) and 1% Penicillin/Streptomycin (PC/SM; Sigma-Aldrich, St. Louis, MO, USA) at 37oC and 5% CO2.
Stock solutions of 5 mM cytosine arabinofuranoside (cytarabine, Ara-C; Wako), 2 mM doxorubicin (doxorubicin, DOX; Wako) and 5 mM vincristine (VCR; Wako) were prepared with physiological saline solution. Methotrexate (MTX; Wako) and idarubicin (IDR; Wako) were diluted with RPMI-1640 and ethanol to prepare 20 mM and 2 mM stock solutions, respectively. Stock solutions of p21 inhibitors UC2288 (5 mM, EMD Millipore, USA) was prepared in DMSO.
1.2. Generation of FLT3-ITD
The pMY-puro-FLT3-ITD plasmid was kindly provided by Dr. Tetsuya Nosaka (Mie University, Tsu, Japan) [14]. pMY-puro plasmid and pMY-puro-FLT3-ITD plasmid were transfected into K562-parent cells, respectively, using Neon Transfection System (Thermo Fisher Scientific, Inc., Japan). K562-parent cells transfected with these plasmids were selected using 2 μg/ml of puromycin.
1.3. Total RNA extraction, RT-PCR and real-time PCR
Total RNA was extracted using Isogen (Nippon Gene, Tokyo, Japan), and cDNA was generated from 500 ng of RNA using the M-MLV Reverse Transcriptase kit (Promega, Madison, Wisconsin, USA). PCR was performed using TaKaRa Ex Taq® DNA Polymerase (Takara Bio Inc., Otsu Japan), and real-time PCR (RT-PCR) was performed with SYBR Premix Ex Taq II (Tli RNase H Plus) (Takara Bio, Otsu, Japan) on LightCycler 2.0 thermal cycler (Roche Diagnostics USA, Indianapolis, IN, USA).
The transcript levels of FN1 and P21cip1 were determined and expressed as the relative ratio to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primer sequences were: FN1 forward 5'-TGAAAGACCAGCAGAGGCATAAG-3', reverse 5'- CTCATCTCCAACGGCATAATGG-3'; P21cip1 forward 5'-CAGGGGAGCAGGCTGAAG -3', reverse 5'- GGCGTTTGGAGTGGTAGAAA -3'; GAPDH forward 5'-TTGCCATCAATGACCCCTTCA-3', reverse 5'-CGCCCCACTTGATTTTGGA-3'. The primer sequences for FLT3 were as previously described [15].
1.4. Cellular proliferation and sensitivity to the cytotoxic agents
Ten thousand cells were cultured with different concentrations of the cytotoxic agents in 200 μl in 96-well plates in absence of FN1 or COL4 at 37oC for 3 days. An MTT assay was done as previously described [16]. In presence of FN1 or COL4, 4 × 104 cells were cultured in 800 μl in 24-well plates with FN1 or COL4 coated plates for 2 hrs., then added various concentrations of the cytotoxic agents at 37 oC for 70hrs, totally 72 hrs. The 50% inhibitory concentration for cellular growth (IC50) was determined as compared to the untreated controls. Each experiment was performed in double, and three independent experiments were performed.
Results
2.1. FN1 induced Ara-C resistance in the K562/FLT3-ITD cells
Both IC50 of K562/mock and K562/FLT3-ITD cells for Ara-C, DOX, MTX, VCR and IDR were confirmed similar to our previous report [15]. In the presence of FN1, IC50 for Ara-C resistance of both K562/mock and K562/FLT3-ITD were increased as compared with that in absence of FN1 (4.2- and 1.9-folds, respectively). In contrast, there were no changes in IC50 for DOX and MTX.
2.2. The FN1 and p21cip1 expression were upregulated in the K562/FLT3-ITD cells
We have focused on the expressional changes of the ECM genes in the K562/mock and K562/FLT3-ITD cells. We compared the expression of CDK2 and P21 genes, chosen from the cDNA microarray analysis, which were reported to be related to the environment mediated-drug resistance. Both FN1 and p21cip1 showed over two-fold upregulation in K562/FLT3-ITD cells compared to mock cells, confirmed by real-time RT-PCR.
2.3. The p21cip1 expression was upregulated in the K562/FLT3-ITD cells in the presence of FN1
We have set to clarify whether ECMs upregulate p21cip1 expression in K562/mock and K562/FLT3-ITD cells. The expression of p21 cip1 in K562/FLT3-ITD cells was peaked at 4 hrs in presence of FN1, but not in COL4.
2.4. FN1 induced Ara-C resistance in the K562/FLT3-ITD cells was reversed by the inhibition of p21cip1
Twenty-four-hour pre-treatment of the leukemia cells with the p21cip1-inhibitor (500nM) before applying to FN1 coated plate resulted in the rescued sensitivity to Ara-C to the same levels as in without FN1 supplement.
Discussion
The presence of the FLT3-ITD mutation in the leukemic cells leads to the relapse of the AML after the first remission with Ara-C treatment. In addition to FLT3-ITD, in this study we have found that FN1 is able induce Ara-C resistance in leukemic cells irrespective of the FLT3-ITD mutation. Furthermore, we have confirmed that p21cip1 participates in Ara-C resistance to FLT3- ITD-expressing leukemic cells in the presence of FN1, which was abolished when co-cultured with the p21cip1 inhibitor.
In this study we used the human leukemia cell line K562, which endogenously expresses tyrosine kinase BCR-ABL1 fusion protein. It was found that BCR-ABL1-expressing leukemic cells express p21cip1 naturally. In current study the expression of FLT3-ITD in the leukemic cells in the presence of FN1 leads to upregulation of p21cip1. Recent studies have revealed that p21cip1 can adopt both pro- and anti-apoptotic functions in response to anti-tumour agents depending on cell type and cellular context [17] [17]. The upregulation of p21cip1 in the presence of FN1 in K562/FLT3-ITD and subsequent increased resistance against Ara-C has a rationale as it is line with the previous findings. The other studies have found that p21cip1 inhibits cell growth when expressed at a peak level and induces cell growth when expressed at inferior levels [18] [19].
Also we have found that p21cip1 may play a major role in the FLT3-ITD-induced Ara-C resistance in presence of bone marrow micro-environment factor. These results of this study would suggest that the leukemic cells with FLT3-ITD can reside in the bone marrow microenvironment, gaining refractory to the Ara-C treatment with the support by of FN1. Further study will be necessary to focus on interference of p21cip1 of FLT3-ITD signalling pathway and FN1 on Ara-C resistance in leukemia.
Presentations (during Nakatani fellowship program)
A part of the above study was presented at national congresses as follow:
• Lkhaasuren Nemekhbaatar, Anar Damdinsuren, Masatoshi Ito, Hideo Tsukamoto, Satomi Asai, Hiromichi Matsushita, Hayato Miyachi “Comparative analysis of proteome and transcriptome in FLT3-ITD transfected leukemia cells”, 22nd Annual Meeting of the Japanese Society Gene Diagnosis and Therapy. 2015, Yokohama, Japan.
• Lkhaasuren Nemekhbaatar, Anar Damdinsuren, Masatoshi Ito, Hideo Tsukamoto, Satomi Asai, Hiromichi Matsushita, Hayato Miyachi “Differential expression analysis of proteome and transcriptome in FLT3-ITD positive leukemia cells”, 62nd National Congress of the Japanese Society of Laboratory Medicine. 2015, Gifu, Japan.
FN1 induces Ara-C resistance of the leukemia cells with FLT3-ITD
Purpose
We aimed to study an involvement of the molecules of the extracellular matrix (ECM), fibronectin (FN1) and collagen 4 (COL4), in the FLT3-ITD-induced chemotherapy resistance of the leukemia cells in the bone marrow microenvironment (BM-ME).
Objectives
1. To investigate the effects of the ECMs (FN1 or COL4) on chemotherapy resistance of leukemia cells.
2. To study the involvement of FLT3-ITD mutation on chemotherapy resistance of leukemia cells in presence of ECMs.
3. To clarify the molecular mechanism and to determine the candidate genes for drug resistance of leukemia cells in presence of ECMs.
Background
Acute myeloid leukemia (AML) is a group of genetically heterogeneous hematological malignancies [1]. Cytarabine (Ara-C) is the main cytotoxic agent used in the chemotherapy of AML. Although the most of the patients show good response after the initial course of treatment based on Ara-C, a part of the patients with a certain cytogenetics relapse [2] [3]. One of such common mutations is an internal tandem duplication of the juxta-membrane domain of the FLT3 (FLT3-ITD), found in 30-40 % of cases with cytogenetically normal AML (CN-AML). FLT3-ITD mutation constitutively activates multiple downstream signalling pathways such as STAT3/5, MAPK/ERK and PI3K/AKT [4] [5].
The bone marrow microenvironment was previously found to mediate a resistance of the leukemic cells against the cytotoxic agents, by providing a safe niche with numerous cytokines/growth factors (i.e., PDGF, VEGF, etc.) and cell-cell surface contact molecules (i.e., CXCR4, VCAM1, etc.) [6, 7, 8, 9, 10, 11]. This phenomenon of cell adhesion-mediated drug resistance (CAM-DR) is mediated by β1 integrins, which connect with FN1, COL4 and other extracellular matrix molecules (ECMs) [12]. Also, the chronic myelogenous cells become resistant to drug-induced apoptosis when adhered to FN1 [12].
On the other hand, BM-ME and FLT3-ITD mutation both mediate an Ara-C resistance in the leukemic cells [12]. But the detailed molecular mechanism of this phenomena are still unclear. In this study, we studied effects of the ECMs (FN1 or collagen 4 (COL4)) on chemotherapy resistance of leukemia cells, and examined a potential role of p21cip1 as downstream signalling pathway of FLT3-ITD in inducing cell adhesion-mediated drug resistance in leukemia cells in presence of ECMs (FN1, COL4). We also confirmed that the inhibition of p21 sensitises the leukemia cells to chemotherapy.
Methods
1.1. Cell lines and reagents
Human leukemia cells K562, MOLM-14 [13] and MV4:11 (ATCC, Manassas, VA, USA) were cultured in RPMI-1640 medium (Wako, Osaka, Japan) containing 10% Fetal bovine Serum (FBS; Corning, USA) and 1% Penicillin/Streptomycin (PC/SM; Sigma-Aldrich, St. Louis, MO, USA) at 37oC and 5% CO2.
Stock solutions of 5 mM cytosine arabinofuranoside (cytarabine, Ara-C; Wako), 2 mM doxorubicin (doxorubicin, DOX; Wako) and 5 mM vincristine (VCR; Wako) were prepared with physiological saline solution. Methotrexate (MTX; Wako) and idarubicin (IDR; Wako) were diluted with RPMI-1640 and ethanol to prepare 20 mM and 2 mM stock solutions, respectively. Stock solutions of p21 inhibitors UC2288 (5 mM, EMD Millipore, USA) was prepared in DMSO.
1.2. Generation of FLT3-ITD
The pMY-puro-FLT3-ITD plasmid was kindly provided by Dr. Tetsuya Nosaka (Mie University, Tsu, Japan) [14]. pMY-puro plasmid and pMY-puro-FLT3-ITD plasmid were transfected into K562-parent cells, respectively, using Neon Transfection System (Thermo Fisher Scientific, Inc., Japan). K562-parent cells transfected with these plasmids were selected using 2 μg/ml of puromycin.
1.3. Total RNA extraction, RT-PCR and real-time PCR
Total RNA was extracted using Isogen (Nippon Gene, Tokyo, Japan), and cDNA was generated from 500 ng of RNA using the M-MLV Reverse Transcriptase kit (Promega, Madison, Wisconsin, USA). PCR was performed using TaKaRa Ex Taq® DNA Polymerase (Takara Bio Inc., Otsu Japan), and real-time PCR (RT-PCR) was performed with SYBR Premix Ex Taq II (Tli RNase H Plus) (Takara Bio, Otsu, Japan) on LightCycler 2.0 thermal cycler (Roche Diagnostics USA, Indianapolis, IN, USA).
The transcript levels of FN1 and P21cip1 were determined and expressed as the relative ratio to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primer sequences were: FN1 forward 5'-TGAAAGACCAGCAGAGGCATAAG-3', reverse 5'- CTCATCTCCAACGGCATAATGG-3'; P21cip1 forward 5'-CAGGGGAGCAGGCTGAAG -3', reverse 5'- GGCGTTTGGAGTGGTAGAAA -3'; GAPDH forward 5'-TTGCCATCAATGACCCCTTCA-3', reverse 5'-CGCCCCACTTGATTTTGGA-3'. The primer sequences for FLT3 were as previously described [15].
1.4. Cellular proliferation and sensitivity to the cytotoxic agents
Ten thousand cells were cultured with different concentrations of the cytotoxic agents in 200 μl in 96-well plates in absence of FN1 or COL4 at 37oC for 3 days. An MTT assay was done as previously described [16]. In presence of FN1 or COL4, 4 × 104 cells were cultured in 800 μl in 24-well plates with FN1 or COL4 coated plates for 2 hrs., then added various concentrations of the cytotoxic agents at 37 oC for 70hrs, totally 72 hrs. The 50% inhibitory concentration for cellular growth (IC50) was determined as compared to the untreated controls. Each experiment was performed in double, and three independent experiments were performed.
Results
2.1. FN1 induced Ara-C resistance in the K562/FLT3-ITD cells
Both IC50 of K562/mock and K562/FLT3-ITD cells for Ara-C, DOX, MTX, VCR and IDR were confirmed similar to our previous report [15]. In the presence of FN1, IC50 for Ara-C resistance of both K562/mock and K562/FLT3-ITD were increased as compared with that in absence of FN1 (4.2- and 1.9-folds, respectively). In contrast, there were no changes in IC50 for DOX and MTX.
2.2. The FN1 and p21cip1 expression were upregulated in the K562/FLT3-ITD cells
We have focused on the expressional changes of the ECM genes in the K562/mock and K562/FLT3-ITD cells. We compared the expression of CDK2 and P21 genes, chosen from the cDNA microarray analysis, which were reported to be related to the environment mediated-drug resistance. Both FN1 and p21cip1 showed over two-fold upregulation in K562/FLT3-ITD cells compared to mock cells, confirmed by real-time RT-PCR.
2.3. The p21cip1 expression was upregulated in the K562/FLT3-ITD cells in the presence of FN1
We have set to clarify whether ECMs upregulate p21cip1 expression in K562/mock and K562/FLT3-ITD cells. The expression of p21 cip1 in K562/FLT3-ITD cells was peaked at 4 hrs in presence of FN1, but not in COL4.
2.4. FN1 induced Ara-C resistance in the K562/FLT3-ITD cells was reversed by the inhibition of p21cip1
Twenty-four-hour pre-treatment of the leukemia cells with the p21cip1-inhibitor (500nM) before applying to FN1 coated plate resulted in the rescued sensitivity to Ara-C to the same levels as in without FN1 supplement.
Discussion
The presence of the FLT3-ITD mutation in the leukemic cells leads to the relapse of the AML after the first remission with Ara-C treatment. In addition to FLT3-ITD, in this study we have found that FN1 is able induce Ara-C resistance in leukemic cells irrespective of the FLT3-ITD mutation. Furthermore, we have confirmed that p21cip1 participates in Ara-C resistance to FLT3- ITD-expressing leukemic cells in the presence of FN1, which was abolished when co-cultured with the p21cip1 inhibitor.
In this study we used the human leukemia cell line K562, which endogenously expresses tyrosine kinase BCR-ABL1 fusion protein. It was found that BCR-ABL1-expressing leukemic cells express p21cip1 naturally. In current study the expression of FLT3-ITD in the leukemic cells in the presence of FN1 leads to upregulation of p21cip1. Recent studies have revealed that p21cip1 can adopt both pro- and anti-apoptotic functions in response to anti-tumour agents depending on cell type and cellular context [17] [17]. The upregulation of p21cip1 in the presence of FN1 in K562/FLT3-ITD and subsequent increased resistance against Ara-C has a rationale as it is line with the previous findings. The other studies have found that p21cip1 inhibits cell growth when expressed at a peak level and induces cell growth when expressed at inferior levels [18] [19].
Also we have found that p21cip1 may play a major role in the FLT3-ITD-induced Ara-C resistance in presence of bone marrow micro-environment factor. These results of this study would suggest that the leukemic cells with FLT3-ITD can reside in the bone marrow microenvironment, gaining refractory to the Ara-C treatment with the support by of FN1. Further study will be necessary to focus on interference of p21cip1 of FLT3-ITD signalling pathway and FN1 on Ara-C resistance in leukemia.
Presentations (during Nakatani fellowship program)
A part of the above study was presented at national congresses as follow:
• Lkhaasuren Nemekhbaatar, Anar Damdinsuren, Masatoshi Ito, Hideo Tsukamoto, Satomi Asai, Hiromichi Matsushita, Hayato Miyachi “Comparative analysis of proteome and transcriptome in FLT3-ITD transfected leukemia cells”, 22nd Annual Meeting of the Japanese Society Gene Diagnosis and Therapy. 2015, Yokohama, Japan.
• Lkhaasuren Nemekhbaatar, Anar Damdinsuren, Masatoshi Ito, Hideo Tsukamoto, Satomi Asai, Hiromichi Matsushita, Hayato Miyachi “Differential expression analysis of proteome and transcriptome in FLT3-ITD positive leukemia cells”, 62nd National Congress of the Japanese Society of Laboratory Medicine. 2015, Gifu, Japan.